Review



fc 131 1096 slide seq arrays fei chen lab n a dead cell removal kit milteny biotec  (Miltenyi Biotec)


Bioz Verified Symbol Miltenyi Biotec is a verified supplier
Bioz Manufacturer Symbol Miltenyi Biotec manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Miltenyi Biotec fc 131 1096 slide seq arrays fei chen lab n a dead cell removal kit milteny biotec
    Fc 131 1096 Slide Seq Arrays Fei Chen Lab N A Dead Cell Removal Kit Milteny Biotec, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 99/100, based on 2564 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/array-seq+slide/Dead+Cell+Removal+Kit/pm37393620-462-300-311
    Average 99 stars, based on 2564 article reviews
    fc 131 1096 slide seq arrays fei chen lab n a dead cell removal kit milteny biotec - by Bioz Stars, 2026-11
    99/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Dissecting the spermatogonial stem cell niche using spatial transcriptomics.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse Anti-CYP11A1 Proteintech Cat# 67264-1-Ig; RRID: AB_2882535 Rabbit anti-PTN Proteintech Cat# 27117-1-AP; RRID: AB_2880763 Goat anti-PTN R&D Systems Cat# AF252SP; RRID: AB_2300563 Mouse anti-Syndecan-4 (5G9) Alexa Fluor 546 Santa Cruz Biotechnology Cat# sc-12766 AF546; RRID: AB_628314 Rabbit anti-Ephrin A1 Abcam Cat# ab124911; RRID: AB_10974078 Mouse anti-VWF Proteintech Cat#: 66682-1-Ig; RRID: AB_2882036 Mouse anti-GFRa1 Alexa Fluor 647 Santa Cruz Biotechnology Cat# sc-271546 AF647; RRID: AB_10649373 Alexa Fluor 488 Secondary Antibody Thermofisher Scientific Cat# A-11008; RRID: AB_143165 Alexa Fluor 594 Secondary Antibody Thermofisher Scientific Cat# A-11012; RRID: AB_141359 Alexa Fluor 647 Secondary Antibody Thermofisher Scientific Cat# A-21447; RRID: AB_141844 Goat anti-GFRa1 R&D Systems Cat# AF714; RRID: AB_355541 PE rat anti-human CD49f/ITGA6 BD Biosciences Cat# 555736; RRID: AB_396079 APC mouse anti-human CD117/KIT BD Biosciences Cat# 550412; RRID: AB_398461 Biological samples Human Testis Tissue Samples Kyle Orwig Lab N/A Mouse Testis Tissue Samples Haiqi Chen Lab N/A Chemicals, peptides, and recombinant proteins Human Recombinant GDNF R&D Systems Cat# 212-GD-050 Rat Recombinant GFRa1 R&D Systems Cat# 560-GR-100 Recombinant FGF2 Invitrogen Cat# 13256-029 Recombinant PTN R&D Systems Cat# 252-PL DAPI Sigma-Aldritch Cat# D9542 ProLongTM Gold Antifade Mountant Sigma-Aldritch Cat# P36934 Hank’s Balanced Salt Solution (HBSS) Thermo Fisher Cat # 24020-117 Collagenase IV Worthington Biochemical Cat# LS004188 Trypsin-EDTA Thermo Fisher Cat# 25200114 DNase I Worthington Biochemical Cat# LS002147 DPBS Thermo Fisher Cat# 14200-075 FBS Thermo Fisher Cat# 10082-147 Anti-PE Microbeads Milteny Biotec Cat# 130-048-801 StemPro-34TM SFM Media Thermo Fisher Cat# 10639011 bFGF Thermo Fisher Cat# 13256-029 Human Ephrin-A1 (EFNA1) R&D Systems Cat# 6417-A1 0.5% Trypsin EDTA Gibco Cat# 25300120 Ghost DyeTM Red 780 Tonbo Biosciences Cat# 13-0865-T100 1:1 Perm/Wash Buffer BD Biosciences Cat# 554723 UltraComp eBeadsTM ThermoFisher Cat# 01-2222-42 Critical commercial assays Illumina NovaSeq 100 Cycle Reagent kit Illumina Cat# 20028319 Nextera XT DNA Library Preparation Kit (96 samples) Illumina Cat# FC-131-1096 Slide-seq Arrays Fei Chen Lab N/A Dead Cell Removal Kit Milteny Biotec Cat# 130-090-101 (Continued on next page) Cell Reports 42, 112737, July 25, 2023 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Raw Slide-seq data GEO BioProject ID: PRJNA668433 Additional raw Slide-seq data UTSW Cloud Drive https://cloud.biohpc.swmed.edu/index. php/s/oCBrZWj6JGjC8E9 Processed data Github https://github.com/thechenlab/Testis_Slide-seq Additional processed data UTSW Cloud Drive https://cloud.biohpc.swmed.edu/index.php/s/ nCM8Px3zFmTpZrk Processed LR interaction data Single Cell Portal Portal ID: SCP2166 Experimental models: Organisms/strains Mouse: 129/SvEv x B6 F1 Hybrids Makoto Nagano Lab N/A Mouse: C57BL/6J The Jackson Laboratory Strain #:000664 Oligonucleotides Template Switch Oligo (AAGCAGTGGTATCA ACGCAGAGTGAATrG+GrG) This paper N/A SMART_PCR_Primer (AAGCAGTGGTATCAACGCAGAGT) This paper N/A Truseq_PCR_Handle (CTACACGACGCTCTTCCGATCT) This paper N/A Truseq P5 (AATGATACGGCGACCACCGAGATCTA CACTCTTTCCCTACACGACGC TCTTCCGATCT) This paper N/A dN-SMRT oligo (AAGCAGTGGTATCAACGCAGAG TGANNNGGNNNB) This paper N/A HCR probes Molecular Instruments N/A Software and algorithms Testis Slide-seq data analysis In house https://github.com/HaiqiChenLab/ Slideseq_SSC_Niche Slide-seq tools In house https://github.com/MacoskoLab/ slideseq-tools RCTD Cable et al.17 https://github.com/dmcable/spacexr NICHES Raredon et al.18 https://github.com/msraredon/NICHES COMMOT Cang et al.26 https://github.com/zcang/COMMOT

    DNA Library Preparation:

    Article Title: Dissecting the spermatogonial stem cell niche using spatial transcriptomics.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse Anti-CYP11A1 Proteintech Cat# 67264-1-Ig; RRID: AB_2882535 Rabbit anti-PTN Proteintech Cat# 27117-1-AP; RRID: AB_2880763 Goat anti-PTN R&D Systems Cat# AF252SP; RRID: AB_2300563 Mouse anti-Syndecan-4 (5G9) Alexa Fluor 546 Santa Cruz Biotechnology Cat# sc-12766 AF546; RRID: AB_628314 Rabbit anti-Ephrin A1 Abcam Cat# ab124911; RRID: AB_10974078 Mouse anti-VWF Proteintech Cat#: 66682-1-Ig; RRID: AB_2882036 Mouse anti-GFRa1 Alexa Fluor 647 Santa Cruz Biotechnology Cat# sc-271546 AF647; RRID: AB_10649373 Alexa Fluor 488 Secondary Antibody Thermofisher Scientific Cat# A-11008; RRID: AB_143165 Alexa Fluor 594 Secondary Antibody Thermofisher Scientific Cat# A-11012; RRID: AB_141359 Alexa Fluor 647 Secondary Antibody Thermofisher Scientific Cat# A-21447; RRID: AB_141844 Goat anti-GFRa1 R&D Systems Cat# AF714; RRID: AB_355541 PE rat anti-human CD49f/ITGA6 BD Biosciences Cat# 555736; RRID: AB_396079 APC mouse anti-human CD117/KIT BD Biosciences Cat# 550412; RRID: AB_398461 Biological samples Human Testis Tissue Samples Kyle Orwig Lab N/A Mouse Testis Tissue Samples Haiqi Chen Lab N/A Chemicals, peptides, and recombinant proteins Human Recombinant GDNF R&D Systems Cat# 212-GD-050 Rat Recombinant GFRa1 R&D Systems Cat# 560-GR-100 Recombinant FGF2 Invitrogen Cat# 13256-029 Recombinant PTN R&D Systems Cat# 252-PL DAPI Sigma-Aldritch Cat# D9542 ProLongTM Gold Antifade Mountant Sigma-Aldritch Cat# P36934 Hank’s Balanced Salt Solution (HBSS) Thermo Fisher Cat # 24020-117 Collagenase IV Worthington Biochemical Cat# LS004188 Trypsin-EDTA Thermo Fisher Cat# 25200114 DNase I Worthington Biochemical Cat# LS002147 DPBS Thermo Fisher Cat# 14200-075 FBS Thermo Fisher Cat# 10082-147 Anti-PE Microbeads Milteny Biotec Cat# 130-048-801 StemPro-34TM SFM Media Thermo Fisher Cat# 10639011 bFGF Thermo Fisher Cat# 13256-029 Human Ephrin-A1 (EFNA1) R&D Systems Cat# 6417-A1 0.5% Trypsin EDTA Gibco Cat# 25300120 Ghost DyeTM Red 780 Tonbo Biosciences Cat# 13-0865-T100 1:1 Perm/Wash Buffer BD Biosciences Cat# 554723 UltraComp eBeadsTM ThermoFisher Cat# 01-2222-42 Critical commercial assays Illumina NovaSeq 100 Cycle Reagent kit Illumina Cat# 20028319 Nextera XT DNA Library Preparation Kit (96 samples) Illumina Cat# FC-131-1096 Slide-seq Arrays Fei Chen Lab N/A Dead Cell Removal Kit Milteny Biotec Cat# 130-090-101 (Continued on next page) Cell Reports 42, 112737, July 25, 2023 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Raw Slide-seq data GEO BioProject ID: PRJNA668433 Additional raw Slide-seq data UTSW Cloud Drive https://cloud.biohpc.swmed.edu/index. php/s/oCBrZWj6JGjC8E9 Processed data Github https://github.com/thechenlab/Testis_Slide-seq Additional processed data UTSW Cloud Drive https://cloud.biohpc.swmed.edu/index.php/s/ nCM8Px3zFmTpZrk Processed LR interaction data Single Cell Portal Portal ID: SCP2166 Experimental models: Organisms/strains Mouse: 129/SvEv x B6 F1 Hybrids Makoto Nagano Lab N/A Mouse: C57BL/6J The Jackson Laboratory Strain #:000664 Oligonucleotides Template Switch Oligo (AAGCAGTGGTATCA ACGCAGAGTGAATrG+GrG) This paper N/A SMART_PCR_Primer (AAGCAGTGGTATCAACGCAGAGT) This paper N/A Truseq_PCR_Handle (CTACACGACGCTCTTCCGATCT) This paper N/A Truseq P5 (AATGATACGGCGACCACCGAGATCTA CACTCTTTCCCTACACGACGC TCTTCCGATCT) This paper N/A dN-SMRT oligo (AAGCAGTGGTATCAACGCAGAG TGANNNGGNNNB) This paper N/A HCR probes Molecular Instruments N/A Software and algorithms Testis Slide-seq data analysis In house https://github.com/HaiqiChenLab/ Slideseq_SSC_Niche Slide-seq tools In house https://github.com/MacoskoLab/ slideseq-tools RCTD Cable et al.17 https://github.com/dmcable/spacexr NICHES Raredon et al.18 https://github.com/msraredon/NICHES COMMOT Cang et al.26 https://github.com/zcang/COMMOT



    Similar Products

    slide-seq array  (Spatial Transcriptomics Inc)
    90
    Spatial Transcriptomics Inc slide-seq array
    Slide Seq Array, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/array-seq+slide/slide+seq+array/pm40181168-69-17-0
    Average 90 stars, based on 1 article reviews
    slide-seq array - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    array-seq slide  (Spatial Transcriptomics Inc)
    90
    Spatial Transcriptomics Inc array-seq slide
    Array Seq Slide, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/array-seq+slide/slide+seq+array/pm39562752-165-56-62
    Average 90 stars, based on 1 article reviews
    array-seq slide - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    slide-seq arrays  (Broad Institute Inc)
    90
    Broad Institute Inc slide-seq arrays
    Slide Seq Arrays, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/array-seq+slide/slide+seqv2/pmc10530051-263-0-9
    Average 90 stars, based on 1 article reviews
    slide-seq arrays - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    slide-seq arrays  (Thermo Fisher)
    90
    Thermo Fisher slide-seq arrays
    KEY RESOURCES TABLE
    Slide Seq Arrays, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/array-seq+slide/pmc10530051-41-0-3
    Average 90 stars, based on 1 article reviews
    slide-seq arrays - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    fc 131 1096 slide seq arrays fei chen lab n a dead cell removal kit milteny biotec  (Miltenyi Biotec)
    99
    Miltenyi Biotec fc 131 1096 slide seq arrays fei chen lab n a dead cell removal kit milteny biotec
    KEY RESOURCES TABLE
    Fc 131 1096 Slide Seq Arrays Fei Chen Lab N A Dead Cell Removal Kit Milteny Biotec, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/array-seq+slide/Dead+Cell+Removal+Kit/pm37393620-462-300-311
    Average 99 stars, based on 1 article reviews
    fc 131 1096 slide seq arrays fei chen lab n a dead cell removal kit milteny biotec - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: Dissecting the spermatogonial stem cell niche using spatial transcriptomics

    doi: 10.1016/j.celrep.2023.112737

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Slide-seq Arrays , Fei Chen Lab , N/A.

    Techniques: Recombinant, DNA Library Preparation, Software